Sample exemplar is used here. Please input exemplar name in the text box below and press "Change" to view it.
|
Soybean GeneChip Exemplar: Gma.1002.2.S1_at
|
Name
|
The Soybean Genome Array is a mixed platform contains probe sets for ~37,500 soybean (Glycine max) transcripts, ~ 15,800 Phytophthora sojae transcripts and ~7,500 Heterodera glycines (cyst nematode) transcripts.
This page shows annotations for soybean exemplars with prefix"Gma".
|
---|
Date last modified
| 2004-11-29 |
---|
Sequence Type | Consensus sequence from Gma.1002.2
|
---|
Probe Sets
| Probe Sequences & Alignment
Probe sets from Gma.1002.2.S1_at: 1. Gma.1002.2.S1_at: Expression Details Probe-Level Intensity |
---|
BLAST and EST alignment Plant Sequence BLAST | 1. BarleyBase Blast 2. NCBI BLAST 3. EBI BLAST 4. GrainGenes BLAST 5. Gramene BLAST 6. TAIR BLAST |
---|
Annotation | 1. BEST BLASTX UniProt: Q9ZWS2, Flavonoid 3-O-galactosyl transferase Length = 455, Expect:3e-61. match=113/165 aa. more
2. BEST BLASTN TIGR Soybean Gene Index: TC208101, weakly similar to UP|Q9ZWS2 (Q9ZWS2) Flavonoid 3-O-galactosyl transferase, partial (46%) Length = 1022, Expect: 0, match=486/489. It may represent same contig. more
3. BEST TBLASTX Barley1 GeneChip Exemplar: Barley1_18184, Contig1818. (4 members) from HarvEST Triticeae v.1.03 assembly 25 [Hordeum vulgare. (1452 letters), Expect= 2e-34, match=36/66 aa. more
4. BEST TBLASTX ATH1 GeneChip Exemplar: 246468_at, ; at|At5g17050; UDP glucose:flavonoid3-o-glucosyltransferase -like protein UDP glucose:flavonoid3-o-glucosyltransferase, Vitis vinifera, EMBL:AF00037. (1383 letters), Expect= 4e-48, match=76/130 aa. more |
---|
Nucleotide Sequence | Total length: 489 >Gma.1002.2.S1_at gb|AW471508; /DB_XREF=si12a12.y1 /CLONE=GENOME SYSTEMS CLONE ID: Gm-c1029-983 ctaaggtagtagttatgaatttctttgaggaattggaaccacctttgtttgttcaagaca tgagaaacaagttgcagtctttgctttatgttgttccacttccttccacgttgttgccac catctgacacagattcaagtggttgcttgtcatggttgggtatgaagaactctaaatcgg tggcttatgtttgctttgggactgtggnggcaccacctccacatgagcttgtggcagtgg cagaggcattggaagaaagtggctttccttttctgtggtctctgaaggaaggtctaatga gtcttttgccaaatgggtttgttgagaggaccaagaagcgtgggaaaatagtgtcttggg ctccacaaacccatgttttggctcatgattctgtaggagtttttgtgactcactgtggag ctaactctgtgattgagagtgtttccagtggtgtgactatgatctgcaggccattctttg gagatcaag
|