Soybean GeneChip Exemplar: Gma.1002.2.S1_at
|
Name
| 
The Soybean Genome Array is a mixed platform contains probe sets for ~37,500 soybean (Glycine max) transcripts, ~ 15,800 Phytophthora sojae transcripts and ~7,500 Heterodera glycines (cyst nematode) transcripts.
This page shows annotations for soybean exemplars with prefix"Gma".
|
|---|
Date last modified
| 2004-11-29 |
|---|
Sequence Type
| Consensus sequence from Gma.1002.2
|
|---|
Probe Sets
| Probe Sequences & Alignment
Probe sets from Gma.1002.2.S1_at:
1. Gma.1002.2.S1_at: Expression Details Probe-Level Intensity
|
|---|
BLAST and EST alignment
Plant Sequence BLAST | 1. BarleyBase Blast 2. NCBI BLAST 3. EBI BLAST 4. GrainGenes BLAST 5. Gramene BLAST 6. TAIR BLAST |
|---|
| Annotation |
1. BEST BLASTX UniProt: Q9ZWS2, Flavonoid 3-O-galactosyl transferase Length = 455, Expect:3e-61. match=113/165 aa.
2. BEST BLASTN TIGR Soybean Gene Index: TC208101, weakly similar to UP|Q9ZWS2 (Q9ZWS2) Flavonoid 3-O-galactosyl transferase, partial (46%) Length = 1022, Expect: 0, match=486/489. It may represent same contig. more
3. BEST TBLASTX Barley1 GeneChip Exemplar: Barley1_18184, Contig1818. (4 members) from HarvEST Triticeae v.1.03 assembly 25 [Hordeum vulgare. (1452 letters), Expect= 2e-34, match=36/66 aa. more
4. BEST TBLASTX ATH1 GeneChip Exemplar: 246468_at, ; at|At5g17050; UDP glucose:flavonoid3-o-glucosyltransferase -like protein UDP glucose:flavonoid3-o-glucosyltransferase, Vitis vinifera, EMBL:AF00037. (1383 letters), Expect= 4e-48, match=76/130 aa. more
|
|---|
BLAST Details |
BLASTN vs UniProt Releas 26 | | # | Species | Subject Sequence Description | Expect | Identity/Match | Identity% | HSP
Details | | 1 | | Q9ZWS2: Flavonoid 3-O-galactosyl transferase Length = 455 | 3e-61 | 113/165 | 68 | View | | 2 | | Q76G23: Anthocyanin 3-O-galactosyltransferase Length = 452 | 2e-48 | 93/160 | 58 | View | | 3 | | Q9SBQ8: UDP-galactose:flavonol 3-O-galactosyltransferase Length = 451 | 1e-47 | 93/159 | 58 | View | | 4 | | UFO7_MANES: (Q40289) Flavonol 3-O-glucosyltransferase 7 (EC 2.4.1.91) (UDP-glucose flavonoid 3-O-glucosyltransferase 7) (Fragment) Length = 287 | 7e-47 | 88/160 | 55 | View | | 5 | | Q9SBQ3: Anthocyanidin 3-O-glucosyltransferase Length = 448 | 8e-44 | 89/164 | 54 | View |
|
|---|
| Nucleotide Sequence |
Total length: 489
>Gma.1002.2.S1_at gb|AW471508; /DB_XREF=si12a12.y1 /CLONE=GENOME SYSTEMS CLONE ID: Gm-c1029-983
ctaaggtagtagttatgaatttctttgaggaattggaaccacctttgtttgttcaagaca
tgagaaacaagttgcagtctttgctttatgttgttccacttccttccacgttgttgccac
catctgacacagattcaagtggttgcttgtcatggttgggtatgaagaactctaaatcgg
tggcttatgtttgctttgggactgtggnggcaccacctccacatgagcttgtggcagtgg
cagaggcattggaagaaagtggctttccttttctgtggtctctgaaggaaggtctaatga
gtcttttgccaaatgggtttgttgagaggaccaagaagcgtgggaaaatagtgtcttggg
ctccacaaacccatgttttggctcatgattctgtaggagtttttgtgactcactgtggag
ctaactctgtgattgagagtgtttccagtggtgtgactatgatctgcaggccattctttg
gagatcaag
|
|---|