Soybean GeneChip Exemplar: Gma.1002.2.S1_at
|
Name
| 
The Soybean Genome Array is a mixed platform contains probe sets for ~37,500 soybean (Glycine max) transcripts, ~ 15,800 Phytophthora sojae transcripts and ~7,500 Heterodera glycines (cyst nematode) transcripts.
This page shows annotations for soybean exemplars with prefix"Gma".
|
|---|
Date last modified
| 2004-11-29 |
|---|
Sequence Type
| Consensus sequence from Gma.1002.2
|
|---|
Probe Sets
| Probe Sequences & Alignment
Probe sets from Gma.1002.2.S1_at:
1. Gma.1002.2.S1_at: Expression Details Probe-Level Intensity
|
|---|
BLAST and EST alignment
Plant Sequence BLAST | 1. BarleyBase Blast 2. NCBI BLAST 3. EBI BLAST 4. GrainGenes BLAST 5. Gramene BLAST 6. TAIR BLAST |
|---|
| Annotation |
1. BEST BLASTX UniProt: Q9ZWS2, Flavonoid 3-O-galactosyl transferase Length = 455, Expect:3e-61. match=113/165 aa. more
2. BEST BLASTN TIGR Soybean Gene Index: TC208101, weakly similar to UP|Q9ZWS2 (Q9ZWS2) Flavonoid 3-O-galactosyl transferase, partial (46%) Length = 1022, Expect: 0, match=486/489. It may represent same contig. more
3. BEST TBLASTX Barley1 GeneChip Exemplar: Barley1_18184, Contig1818. (4 members) from HarvEST Triticeae v.1.03 assembly 25 [Hordeum vulgare. (1452 letters), Expect= 2e-34, match=36/66 aa. more
4. BEST TBLASTX ATH1 GeneChip Exemplar: 246468_at, ; at|At5g17050; UDP glucose:flavonoid3-o-glucosyltransferase -like protein UDP glucose:flavonoid3-o-glucosyltransferase, Vitis vinifera, EMBL:AF00037. (1383 letters), Expect= 4e-48, match=76/130 aa.
|
|---|
BLAST Details |
BLASTX vs ATH1 Exemplars | | # | Species | Subject Sequence Description | Expect | Identity/Match | Identity% | HSP
Details | | 1 | arabidopsis | 246468_at:at|At5g17050; UDP glucose:flavonoid3-o-glucosyltransferase -like protein UDP glucose:flavonoid3-o-glucosyltransferase, Vitis vinifera, EMBL:AF00037. (1383 letters) | 4e-48 | 76/130 | 58 | View | | 2 | arabidopsis | 246419_at:at|At5g17030; UDP glucose:flavonoid3-o-glucosyltransferase -like protein UDP glucose:flavonoid3-o-glucosyltransferase, Vitis vinifera, EMBL:AF000372;supported byfull-length cDNA: Ceres:4234. (1380 letters) | 7e-44 | 67/118 | 56 | View | | 3 | arabidopsis | 261804_at:at|At1g30530; UDP glucose:flavonoid3-o-glucosyltransferase, putative similar to UDP glucose:flavonoid3-o-glucosyltransferase GB:AAB81683 GI:2564114 from [Vitisvinifera];supported by full-length cDNA: Ceres:38407. (1362 letters) | 6e-43 | 67/118 | 56 | View | | 4 | arabidopsis | 246467_at:at|At5g17040; UDP glucose:flavonoid3-o-glucosyltransferase -like protein UDP glucose:flavonoid3-o-glucosyltransferase, Vitis vinifera, EMBL:AF00037. (1419 letters) | 5e-42 | 65/118 | 55 | View | | 5 | arabidopsis | 264873_at:at|At1g24100; putative indole-3-acetatebeta-glucosyltransferase similar to GB:AAB64022; supported by cDNA:gi_14423541_gb_AF387008.1_AF38700. (1383 letters) | 6e-31 | 57/118 | 48 | View |
|
|---|
| Nucleotide Sequence |
Total length: 489
>Gma.1002.2.S1_at gb|AW471508; /DB_XREF=si12a12.y1 /CLONE=GENOME SYSTEMS CLONE ID: Gm-c1029-983
ctaaggtagtagttatgaatttctttgaggaattggaaccacctttgtttgttcaagaca
tgagaaacaagttgcagtctttgctttatgttgttccacttccttccacgttgttgccac
catctgacacagattcaagtggttgcttgtcatggttgggtatgaagaactctaaatcgg
tggcttatgtttgctttgggactgtggnggcaccacctccacatgagcttgtggcagtgg
cagaggcattggaagaaagtggctttccttttctgtggtctctgaaggaaggtctaatga
gtcttttgccaaatgggtttgttgagaggaccaagaagcgtgggaaaatagtgtcttggg
ctccacaaacccatgttttggctcatgattctgtaggagtttttgtgactcactgtggag
ctaactctgtgattgagagtgtttccagtggtgtgactatgatctgcaggccattctttg
gagatcaag
|
|---|