Wheat GeneChip Exemplar: Ta.10069.1.S1_at
|
Name
|
|
---|
Date last modified
| 2004-12-12 |
---|
Sequence Type | Consensus sequence from Ta.10069.1
|
---|
Probe Sets
| Probe Sequences & Alignment
Probe sets from Ta.10069.1.S1_at: 1. Ta.10069.1.S1_at: Expression Details Probe-Level Intensity |
---|
Rice Genome Alignment | Genome Alignment at Gramene
On the Gramene entry page, under the "Location of hits" section, select one of the locations to go to the genome browser (ContigView) page, then under "Detailed view" section, select "arrays" menu and check the platforms to be displayed. |
---|
BLAST and EST alignment Plant Sequence BLAST | 1. BarleyBase Blast 2. NCBI BLAST 3. EBI BLAST 4. GrainGenes BLAST 5. Gramene BLAST 6. TAIR BLAST |
---|
Annotation | 1. BEST BLASTX UniProt: ASPR_HORVU, (P42210) Phytepsin precursor (EC 3.4.23.40) (Aspartic proteinase) Length = 508, Expect:0. match=311/412 aa. more
2. BEST BLASTN TIGR Wheat Gene Index: TC220292, similar to UP|ASPR_HORVU (P42210) Phytepsin precursor (Aspartic proteinase) , partial (88%) Length = 2293, Expect: 0, match=1736/1741. It may represent same contig.
3. BEST TBLASTX Barley1 GeneChip Exemplar: Barley1_03144, Contig3144 (98 members) from HarvEST Triticeae v. 1.03 assembly 25 [Hordeum vulgare] Length = 1717, Expect= 0, match=321/409 aa. more
4. BEST TBLASTX ATH1 GeneChip Exemplar: 264344_at, ; |At1g11910; putative aspartic proteinase similar to GB:AAC49730;supported by full-length cDNA: Ceres:8972. Length = 1521, Expect= 0, match=192/276 aa. more |
---|
BLAST Details |
BLASTN vs TIGR Wheat Gene Index GmGI Release 12 | # | Species | Subject Sequence Description | Expect | Identity/Match | Identity% | HSP Details | 1 | wheat | TC220292: similar to UP|ASPR_HORVU (P42210) Phytepsin precursor (Aspartic proteinase) , partial (88%) Length = 2293 | 0 | 1736/1741 | 99 | View | 2 | wheat | TC220289: similar to PDB|1QDM_A.0|5822248|1QDM_A Chain A, Crystal Structure Of Prophytepsin, A Zymogen Of A Barley Vacuolar Aspartic Proteinase. {Hordeum vulgare;} , partial (90%) Length = 1779 | 0 | 1123/1311 | 85 | View | 3 | wheat | BQ242530: Length = 454 | 0 | 391/440 | 88 | View | 4 | wheat | TC220295: similar to UP|APR1_ORYSA (Q42456) Aspartic proteinase oryzasin 1 precursor , partial (25%) Length = 1248 | 0 | 384/403 | 95 | View | 5 | wheat | TC220294: similar to PDB|1QDM_A.0|5822248|1QDM_A Chain A, Crystal Structure Of Prophytepsin, A Zymogen Of A Barley Vacuolar Aspartic Proteinase. {Hordeum vulgare;} , partial (51%) Length = 896 | 4e-94 | 331/383 | 86 | View |
|
---|
Nucleotide Sequence | Total length: 1753 >Ta.10069.1.S1_at gb|BJ233195; gtggtctgctcctcttccggtctcacttcatcggtattctctctctctctgtaatttgca gctncgcggcgcaaccatgggaactggccgcctcgtgttccacctcctcctcctctccaa cgtgctcctccatgccctcctcgccacgcccgcggagggccttgtccgcatcgcgctgaa gaagcgaccagtcgacgagaacggcgtcgtcctcgtcgctggccgnctcaccggagatga cgccgaggcaaagggccacgtcgtggcactgaagaactaccacaacgctcagtaccacgg cgagatcggcatcggaacgccgccgcagaancttcaccgtcatcttcgacacaggcagct ccaacctctgggtgccctcctccaagtgcttcctctcgattgcatgctacttccatgcga gctacaaggccaagcggtccagcacgtacaagaagaatggaaaaatagttgcaattcagt atggaactggtgcaatttctggctatgttagccaggacaatgtgcaagttggtgatgtan ttgtgaaaaatcaggattttattgaagctaccagggaaccaagtattacttttatggttg caaaatttgatggcatttttggtcttgggtttaaagaaatctcgaaaggtgatgttgtac ctgtctggtataacatggttagccaaggcctagttagtagccctattttctcattgtggt tgaacagacatgccggtgaagggcaagggggagaaattgtgtttggaggaattgatccta atcatcataacggagatcatacatatgtccctgttactaggaagggatactggcagtttg atatgggtgatgtcttgattggaggaaattccacaggattatgtgcgtctcgctgtgcag ctatagcagattctggaacttcattgctttctggtcccacggcgataattactcaaataa atgaaaagatcggtgcacctggggtagtcagccaagagtgcaaggccgttgtttctcagt atgggcaacggatcctanatctgctgttaaaggagatggatccatcaaaaatatgctctt tagtcggtctatgtactccagatggaacacaaggtgtaagggctggtagtcgaagtgtgc tagatcatgaaggtgggagatcaaatgatgtcatgtgccatgcttgtgagatggctgttg tatggatgacgaaccaacttgcaaagaatcaaactcaggatcttatttttaagtacatta atcagctatgtgaccgtattcctagccctatgggagaatcatctgtggactgcggcagac ttgcatccatgcctgacatcgctttctccatcgggggcaaacagtttgtgctgacaccag agcaatatatcctgaagatcggtgagggggatgctacccagtgcatcagcggattcacgg ccatggacattcctcgtccccgtggccctctctggatcctgggcgatatattcatgggag cctaccataccgtcttcgactatggcaacatgaagattgggttcgcgaaggcggcatagg gttcccccgtggtgggcggatgagccgcagagctgtctaatcttcaggtcggtttggtct tgggcatgcaaagcatgtgtgtgcatatgttacatgcttaataatgctcgtatgatccga gataataataaacctgtctgttatgatttgtccaatataatgaggcaggctttcatactc annannnannggc
|