Sugarcane 8K GeneChip Exemplar: Sof.1126.2.S1_at
|
Name
|
|
---|
Date last modified
| 2005-07-04 |
---|
Sequence Type | Consensus sequence from Sof.1126.2
|
---|
Probe Sets
| Probe Sequences & Alignment
Probe sets from Sof.1126.2.S1_at: 1. Sof.1126.2.S1_at: Expression Details Probe-Level Intensity |
---|
Genome Alignment |
|
---|
BLAST and EST alignment | 1. BarleyBase Blast 2. NCBI BLAST 3. EBI BLAST 4. GrainGenes BLAST 5. Gramene BLAST 6. TAIR BLAST |
---|
Annotation | 1. BEST BLASTX UniProt: Q5Z6I7_ORYSA, (Q5Z6I7) Embryogenesis transmembrane protein-like Length = 968, Expect:2e-84. match=188/398 aa.
2. BEST BLASTN TIGR Sugarcane 8K Gene Index: TC50516, weakly similar to UP|O24564 (O24564) Embryogenesis transmembrane protein, partial (18%) Length = 2128, Expect: 0, match=646/661. It may represent same contig. more
3. BEST TBLASTX Barley1 GeneChip Exemplar: Barley1_49972, Contig49972 (1 member:rbags23g22) from HarvEST Triticeae v. 1.03 assembly 25 [Hordeum vulgare] Length = 656, Expect= 1e-35, match=61/133 aa. more
4. BEST TBLASTX ATH1 GeneChip Exemplar: 254948_at, |At4g11000 putative protein various predicted proteins, Arabidopsis thaliana Length = 1221, Expect= 7e-06, match=18/33 aa. more |
---|
BLAST Details |
BLASTN vs UniProt Releas 26 | # | Species | Subject Sequence Description | Expect | Identity/Match | Identity% | HSP Details | 1 | | Q5Z6I7_ORYSA: (Q5Z6I7) Embryogenesis transmembrane protein-like Length = 968 | 2e-84 | 188/398 | 47 | View | 2 | | Q5Z567_ORYSA: (Q5Z567) Embryogenesis transmembrane protein-like Length = 856 | 1e-73 | 171/398 | 42 | View | 3 | | Q5Z575_ORYSA: (Q5Z575) Putative embryogenesis transmembrane protein Length = 1276 | 9e-72 | 168/398 | 42 | View | 4 | | Q5ZA82_ORYSA: (Q5ZA82) Embryogenesis transmembrane protein-like Length = 844 | 3e-71 | 165/388 | 42 | View | 5 | | Q5Z570_ORYSA: (Q5Z570) Embryogenesis transmembrane protein-like Length = 953 | 3e-70 | 169/409 | 41 | View |
|
---|
Nucleotide Sequence | Total length: 1164 >Sof.1126.2.S1_at gb|CA163321 cctcgccggcgacccaatccttcacataacctatccccagagatacctggctttcttcta ctgcaacgcgacagctttcgtcgcatcgctggttatcctgatcctcctcctaagcagcac attcagcacccaaggaatcaagtactacgcactgcaggtcgccatgatcctggaccttct tgggctgattggcgcctatgctgccgggagttgcaagcaagtgtccaaatccgtgtacat ctcggtcattgtggttccagtgttcctctatgttggcatccatgttctggtgttcatgct tgaagtcttcccaaatcatgccacatggagggagatgctgaaggacaagctggagaagtc catccccgaatggctcaagaagttgtttgagccacagaccgaggaggaagatgaggaaat gaaatggaaattggagaagagccgcaagctcctactgctccttgccattcttgcagcagg cctcacataccangccggcatgagtcccccgggcggcttctggcaacagaacaagacagg ccatctcattggcaacccagtgctcaatgacaactacccacgtcgttacctngnnnncnt nnnctgcaatgcaactgccttcgttgcatctctggccatcatcatgctgctggttaacag nannnnnnngnnnnannnnnnnnnnnnctatgcactcagngtgtgcgtgatccttgacct ggttgggctcatgggtgcgtntgctgcagggngctccaggaaggtatncacatccatata tgtcttcgtcctggtctttgcagttctaatatgcatcgnnctccaagttattctggttgt gtcnnagtcgnttcagggtctcttgcagagactcctgtccttcntcgangtaanagagga ngaagctggtgacacattgccgcatacagctgctgatncagaggcacaagatccctggta taagaagttgcccaaatacntgttgctnctngcngcacttgcagcngctgtcacttacca agccgccatgaacccncccggtgggctctggggcganggncaaantgnccacatagctgg tgatccagttcttnggagcacctatccacgccgttataaggccttcttctactgcaacgc gactttctttatggcttctctggt
|