Sugarcane 8K GeneChip Exemplar: Sof.1126.2.S1_at
|
Name
|
|
---|
Date last modified
| 2005-07-04 |
---|
Sequence Type | Consensus sequence from Sof.1126.2
|
---|
Probe Sets
| Probe Sequences & Alignment
Probe sets from Sof.1126.2.S1_at: 1. Sof.1126.2.S1_at: Expression Details Probe-Level Intensity |
---|
Genome Alignment |
|
---|
BLAST and EST alignment | 1. BarleyBase Blast 2. NCBI BLAST 3. EBI BLAST 4. GrainGenes BLAST 5. Gramene BLAST 6. TAIR BLAST |
---|
Annotation | 1. BEST BLASTX UniProt: Q5Z6I7_ORYSA, (Q5Z6I7) Embryogenesis transmembrane protein-like Length = 968, Expect:2e-84. match=188/398 aa. more
2. BEST BLASTN TIGR Sugarcane 8K Gene Index: TC50516, weakly similar to UP|O24564 (O24564) Embryogenesis transmembrane protein, partial (18%) Length = 2128, Expect: 0, match=646/661. It may represent same contig.
3. BEST TBLASTX Barley1 GeneChip Exemplar: Barley1_49972, Contig49972 (1 member:rbags23g22) from HarvEST Triticeae v. 1.03 assembly 25 [Hordeum vulgare] Length = 656, Expect= 1e-35, match=61/133 aa. more
4. BEST TBLASTX ATH1 GeneChip Exemplar: 254948_at, |At4g11000 putative protein various predicted proteins, Arabidopsis thaliana Length = 1221, Expect= 7e-06, match=18/33 aa. more |
---|
BLAST Details |
BLASTN vs TIGR Maize Gene Index ZMGI Release 15 | # | Species | Subject Sequence Description | Expect | Identity/Match | Identity% | HSP Details | 1 | S.officinarum | TC50516: weakly similar to UP|O24564 (O24564) Embryogenesis transmembrane protein, partial (18%) Length = 2128 | 0 | 646/661 | 97 | View | 2 | S.officinarum | TC50515: similar to UP|O24564 (O24564) Embryogenesis transmembrane protein, partial (3%) Length = 745 | 2e-81 | 233/261 | 89 | View | 3 | S.officinarum | CA166310: Length = 735 | 8e-72 | 279/331 | 84 | View | 4 | S.officinarum | TC56314: weakly similar to UP|O24564 (O24564) Embryogenesis transmembrane protein, partial (7%) Length = 909 | 1e-58 | 214/246 | 86 | View | 5 | S.officinarum | CA089161: Length = 681 | 4e-52 | 176/204 | 86 | View |
|
---|
Nucleotide Sequence | Total length: 1164 >Sof.1126.2.S1_at gb|CA163321 cctcgccggcgacccaatccttcacataacctatccccagagatacctggctttcttcta ctgcaacgcgacagctttcgtcgcatcgctggttatcctgatcctcctcctaagcagcac attcagcacccaaggaatcaagtactacgcactgcaggtcgccatgatcctggaccttct tgggctgattggcgcctatgctgccgggagttgcaagcaagtgtccaaatccgtgtacat ctcggtcattgtggttccagtgttcctctatgttggcatccatgttctggtgttcatgct tgaagtcttcccaaatcatgccacatggagggagatgctgaaggacaagctggagaagtc catccccgaatggctcaagaagttgtttgagccacagaccgaggaggaagatgaggaaat gaaatggaaattggagaagagccgcaagctcctactgctccttgccattcttgcagcagg cctcacataccangccggcatgagtcccccgggcggcttctggcaacagaacaagacagg ccatctcattggcaacccagtgctcaatgacaactacccacgtcgttacctngnnnncnt nnnctgcaatgcaactgccttcgttgcatctctggccatcatcatgctgctggttaacag nannnnnnngnnnnannnnnnnnnnnnctatgcactcagngtgtgcgtgatccttgacct ggttgggctcatgggtgcgtntgctgcagggngctccaggaaggtatncacatccatata tgtcttcgtcctggtctttgcagttctaatatgcatcgnnctccaagttattctggttgt gtcnnagtcgnttcagggtctcttgcagagactcctgtccttcntcgangtaanagagga ngaagctggtgacacattgccgcatacagctgctgatncagaggcacaagatccctggta taagaagttgcccaaatacntgttgctnctngcngcacttgcagcngctgtcacttacca agccgccatgaacccncccggtgggctctggggcganggncaaantgnccacatagctgg tgatccagttcttnggagcacctatccacgccgttataaggccttcttctactgcaacgc gactttctttatggcttctctggt
|