Sample exemplar is used here. Please input exemplar name in the text box below and press "Change" to view it.
|
Cornchip0 Pilot GeneChip Exemplar: Zm1.14139.1.A1_at
|
Name
| 
|
|---|
Date last modified
| 2004-11-29 |
|---|
Sequence Type
| mRNA from Zm1.14139.1.A1_at
|
|---|
Probe Sets
| Probe Sequences & Alignment
Probe sets from Zm1.14139.1.A1_at:
1. Zm1.14139.1.A1_at: Expression Details Probe-Level Intensity
|
|---|
| Rice Genome Alignment | Genome Alignment at Gramene
On the Gramene entry page, under the "Location of hits" section, select one of the locations to go to the genome browser (ContigView) page, then under "Detailed view" section, select "arrays" menu and check the platforms to be displayed. |
|---|
BLAST and EST alignment
Plant Sequence BLAST | 1. BarleyBase Blast 2. NCBI BLAST 3. EBI BLAST 4. GrainGenes BLAST 5. Gramene BLAST 6. TAIR BLAST |
|---|
| Annotation |
1. BEST BLASTX UniProt: Q7XBA4_ORYSA, (Q7XBA4) Cysteine protease CP1 (Cysteine proteinase CP1) Length = 358, Expect:5e-41. match=75/82 aa. more
2. BEST BLASTN TIGR Maize Gene Index: TC258124, similar to UP|Q7XBA4 (Q7XBA4) Cysteine protease CP1, partial (83%) Length = 1399, Expect: 0, match=481/482. It may represent same contig. more
3. BEST TBLASTX Barley1 GeneChip Exemplar: Barley1_06776, Contig6776 (10 members) from HarvEST Triticeae v. 1.03 assembly 25 [Hordeum vulgare] Length = 1188, Expect= 1e-35, match=45/54 aa. more
4. BEST TBLASTX ATH1 GeneChip Exemplar: 262796_at, ; at|At1g20850; cysteine proteinase XCP2 identical to papain-type cysteine endopeptidase XCP2 GI:6708183 from [Arabidopsis thaliana] Length = 1071, Expect= 3e-46, match=70/80 aa. more
5. BEST BLASTN Maize 18K GeneChip Exemplar: Zm.14139.1.A1_at, Zm1.14139.1.A1_a. (482 letters), Expect= 0, match=482/482 base. more
6. BEST BLASTN Maize 58K Oligo Array Element: MZ00056455, TC223611 Length = 1434, Expect= 0, match=481/482 base. more
|
|---|
| Nucleotide Sequence |
Total length: 482
>Zm1.14139.1.A1_at Zm1.14139.1.A1_at
AGGCGTCCGGGAGGCACTTCCAGTTCTACAGCGGGGGCGTGTTCGATGGACCGTGCGGGT
CGGAGCTGGACCACGGCGTGGCGGCGGTGGGCTACGGCAGCAGCAAGGGGCAGGACTACA
TCATCGTCAAGAACTCGTGGGGCACCCACTGGGGCGAGAAGGGCTACATCCGCATGAAGA
GGGGCACCGGCAAGCCGGAGGGCCTCTGCGGCATCAACAAGATGGCATCCTACCCGACCA
AGGACCATTGATGGATCATGGACGACGGAGATCATATCTATCTTCCCTTCCCTTTCATCC
GACTCTTTCGATTTCCATCGTTTGCCCCCTTTTCCTGAATGTGTGTGNTTTTTTTTATAT
ATTACTGTGTCAAGTAATTTCTCGATGGATCGATCGAGGAAGAACGACAAACATGCACTC
AAGCACGAGCGCAGCAATGTCATCTTTCTCTTCATTTGGTGCGTTGAAATGACGAATATC
AA
|
|---|